2025 Impact Factor: 1.5
2025 CiteScore: 2.2
pISSN: 1735-1502
eISSN: 1735-5249
Chairman:
Mostafa Moin, M.D.
Editors-in-Chief:
Masoud Movahedi, M.D.
Vol 24 No 2 (2025)
Natural killer (NK) cells are crucial components of the innate immune system and have emerged as significant players in the pathogenesis of heart diseases. This review discusses recent findings regarding the multifaceted roles of NK cells in various cardiac conditions, including coronary artery disease, myocardial infarction, heart failure, myocarditis, and heart transplantation. It outlines the NK cell subsets, particularly CD56-bright and CD56-dim variations, their functional characteristics, cytokine profiles, and the inflammatory pathways they are involved. The review discusses both the beneficial and detrimental effects of NK cell activity on cardiac pathology by underlining their participation in immune regulation, tissue repair, and graft rejection dynamics. Additionally, we have addressed the impact of NK-cell–oriented environmental signals and discussed potential therapeutic approaches, such as immunomodulatory and anti-inflammatory strategies targeting NK cells. This review was therefore geared towards integrating available studies in understanding NK cell dynamics in heart disease and offering insights for future clinical interventions.
Non-Small Cell Lung Cancer (NSCLC) patients undergoing Immune Checkpoint Inhibitors (ICIs) therapy exhibit diverse clinical outcomes. The Lung Immune Prognostic Index (LIPI) may emerge as a potential prognostic marker. This study systematically reviews and meta-analyzes the prognostic value of LIPI in predicting the clinical efficacy of ICIs therapy for NSCLC patients. A thorough literature review was performed using the Cochrane Library, Web of Science, PubMed, and Embase, following PRISMA guidelines. Studies assessing LIPI’s predictive value in NSCLC patients treated with ICIs were included. Effect sizes were aggregated utilizing a fixed-effects model. The studies featured in the review were appraised using the Newcastle-Ottawa Scale for quality assessment. Eight studies were incorporated into the meta-analysis, encompassing various treatment lines and ICIs. No substantial heterogeneity was detected across the studies. The meta-analysis revealed that the low-risk group exhibited significantly extended overall survival (OS) (HR=3.18, 95%CI: 2.78~3.59 and progression-free survival (PFS) (HR=1.60, 95%CI: 1.4~61.74, underscoring the predictive significance of LIPI for NSCLC patients treated with ICI therapy. No significant publication bias was detected. LIPI demonstrates potential as a prognostic marker for NSCLC patients receiving ICI therapy, contributing to the development of therapeutic strategies. Further prospective researches are required to investigate its relationship with factors such as tumor mutational burden, PD-L1 and PD-1.
Objective: To analyze the clinical efficacy and influencing factors of budesonide inhalation therapy in adult Cough variant asthma (CVA).
Methods: This retrospective study involved 223 CVA patients who were treated in the hospital from January 2022 to February 2024. These patients received standard symptomatic treatment (such as cough suppression, expectoration, and anti-infection therapies), along with budesonide inhalation therapy. The main objective of the study was to evaluate the clinical effects before and after treatment, including lung function, serum inflammatory factor levels, and immune function, while also recording any adverse reactions that occurred during treatment. We classified the patients into effective and ineffective groups based on treatment outcomes, collected clinical factors related to efficacy, and used logistic regression analysis to investigate the factors affecting treatment effectiveness.
Results: After treatment, the lung function indicators of patients showed significant improvement, with the forced expiratory volume in one second (FEV1), forced vital capacity (FVC), and peak expiratory flow (PEF) all increasing compared to before treatment. At the same time, the levels of tumor necrosis factor-alpha (TNF-α), interleukin-4 (IL-4), and immunoglobulin E (IgE) in the serum decreased. In terms of immune function, the levels of CD3+ and CD4+ cells were increased, while the level of CD8+ cells decreased. Thirteen patients (5.83%) experienced nausea and indigestion during the treatment process, nine patients (4.04%) had drowsiness and fatigue, and seven patients (3.14%) had discomfort in the throat. Based on the therapeutic efficacy evaluation after treatment, patients were divided into an effective group (n=188) and an ineffective group (n=35). Further multivariate logistic regression analysis revealed that older age (OR=1.570), lower levels of 25-hydroxyvitamin D3 [25(OH)D3] (OR=0.798), and high levels of tumor necrosis factor-alpha (TNF-α) (OR=1.850) increased the risk of reduced therapeutic efficacy.
Conclusion: Budenoside inhalation therapy is effective for CVA patients, as it can improve lung function, reduce inflammation, and enhance immune function. However, factors such as age, 25(OH)D3, and TNF-α may influence the treatment outcomes.
The cardinal features of asthma include airway inflammation, airway hyper responsiveness (AHR) and airway remodeling. Exosomes help orchestrate the immune response and contain microRNAs (miRNAs) such as miRNA-155 and miRNA-221 which play significant roles in the pathogenesis and exacerbations of severe asthma. In this study, we aimed to investigate the exosomal expression of miRNAs (155, 221) in the serum of severe asthma patients.
Eighteen moderate-to-severe asthma patients and eighteen healthy subjects were recruited for this study. Serum exosomes were isolated and characterized according to their shape, size, and exosomal markers by transmission electron microscopy, dynamic light scattering (DLS) and flow cytometry, respectively. Exosomal miRNA extraction and quantitative real-time PCR (qRT-PCR) were used to measure miR-155 and miR-221. Besides the forced expiratory volume in 1 second and forced vital capacity (FVC) were evaluated in the patient groups.
Round exosomes with a mean size of 25.8 nm were isolated from serum of asthmatic patients. Flow cytometry shows high expression of CD63 and CD81 on isolated exosomes. Serum exosomes from severe asthma patients and healthy donors contained miR-155 and miR-221 but miR-155 and miR-221 expression levels were significantly increased in severe asthma patients. There was a positive correlation between miR-221 expression and FVC).
Receiver operating characteristic (ROC) analysis indicated that miR-155 and miR-221 had an excellent diagnostic efficiency in predicting asthma (AUC=0.91 and AUC=0.76, respectively). Serum exosomal miR-155 and miR-221 may be a potential biomarker for severe asthma. However, the results need to be validated in another cohort, and further studies with larger samples size should be conducted on the effects of these miRNAs on effector cells.
Asthma and Chronic Obstructive Pulmonary Disease (COPD) are prevalent chronic respiratory conditions that may impact clinical outcomes in patients with COVID-19. This study aimed to evaluate the influence of asthma and COPD on the outcomes of hospitalized COVID-19 patients.
This retrospective observational study, conducted in 2021 at Shahid Mohammadi Hospital, Bandar Abbas, Iran, included 1777 COVID-19 patients. Data on demographics, comorbidities, and clinical parameters were retrieved from the hospital’s COVID-19 registry. Logistic regression analysis was used to evaluate the impact of asthma and COPD on clinical outcomes.
Asthma was diagnosed in 83 patients (4.7%) and COPD in 19 patients (1.0%), with a mean age of 50.5 ± 17.5 years. The mortality rate was highest in the COPD group (31.6%), followed by the asthma group (20.5%) and the group without obstructive diseases (13.5%). No significant differences were found in intensive care unit (ICU) admission, mechanical ventilation, or mortality associated with asthma or COPD. Age and comorbidities were significant factors influencing mortality.
This study found no significant impact of asthma or COPD on ICU admission, mechanical ventilation, or mortality rates among hospitalized COVID-19 patients.
The exact mechanisms underlying impaired wound healing in diabetes are not fully understood. In this study, we aimed to investigate the effect of classical and non-classical monocyte ratios along with TNF-α and TGF-β plasma levels on diabetic wound healing.
Twenty-four patients with confirmed type 2 diabetes and twenty healthy controls were enrolled in this study. The peripheral blood mononuclear cells (PBMC) isolation was performed by Ficoll-Paque density gradient centrifugation method. The frequency of different subsets of monocytes was characterized in diabetic patients and healthy controls using flow cytometry. TNF-α and TGF-β plasma levels were measured by the enzyme-linked immunosorbent assay (ELISA) method.
We found a significant difference in the frequency of classical and non-classical monocytes in healthy controls and diabetic patients. The plasma level of TNF-α was higher in diabetic patients than in healthy controls, and its level was associated with wound grade. Moreover, the plasma level of TGF-β was lower in diabetic patients rather than healthy controls. Also, our data showed a higher percentage of non-classical monocytes as wound grade increased.
In conclusion, the wound healing process is affected by diabetes via changes in non-classical and classical monocyte percentages, which may be the result of TNF-α increase and TGF-β levels decreasing in diabetic patients’ plasma.
europathic pain can arise from injury or illness affecting the somatosensory system. It can also be triggered by cancer or chemotherapy drugs like paclitaxel. Researchers have indicated that magnesium sulfate may help in preventing neuropathy. This study aimed to investigate the effect of magnesium sulfate on paclitaxel-induced neuropathic pain by inhibiting the Tumor Necrosis Factor (TNF) Alpha - receptor-associated factor 6 - Nuclear factor kappa-light-chain-enhancer of activated B cells (TNF-α-TRAF6-NF-κB) axis.
Twenty-four male rats were divided into four groups: experiment group (E)-1, E2, E3, and the control group (Co). The experimental groups and the control group received paclitaxel at a dosage of 8 mg/kg every other day, totaling four injections over seven days. In addition, magnesium sulfate was administered daily in three doses of 300, 150, and 75 mg/kg, amounting to seven injections over the course of seven days. On the seventh day, peripheral blood samples were collected from the rats, and sera were used for the analysis of TNF-α serum levels and MicroRNA-146a-5p expression using ELISA and qRT-PCR methods, respectively.
The serum levels of TNF-α increased in the E1, E2, and E3 groups compared to the control group. However, there was a gradual decrease in the E1, E2 and E3 groups. The miR-146a-5p expression declined in the E1 group and increased in the E2 and E3 groups compared to the control group.
This study demonstrated that administering 300 and 150 mg of magnesium sulfate decreased TNF-α synthesis and reduced the function of the TNF-α-TRAF6-NF-κB axis during the initiation step.
, Maryam Soleimani Bavani
, Zahra Alizadeh
, Milad Mirmoghtadaei
, Leila Shakerian
, Seiamak Bahram
, Anne Molitor
, Raphael Carapito
, Leila Moradi
, Anahita Razaghian
, Raheleh Assari
, Masoud Movahedi
, Mansoureh Shariat
, Massoud Houshmand
, Laleh Habibi
, Amir Ali Hamidieh
, Mahmoud Reza Ashrafi , Zahra Pourpak
Ataxia Telangiectasia (A-T) is a rare autosomal recessive neurodegenerative disease caused by mutations in the ataxia telengiectasia mutated (ATM) gene. The gene is on chromosome 11q22-23 and codes for the protein kinase ATM, which plays an essential role in DNA damage repair. In this study, we review the clinical characteristics of 13 A-T patients, 2 of whom displayed novel mutations.
Thirteen patients with ataxia-telangiectasia from 10 unrelated families were referred to Immunology, Asthma and Allergy Research Institute, Tehran, Iran. After clinical confirmation, blood samples were collected from the patients and their parents. Genetic analysis for 8 patients was conducted using whole-exome sequencing; in the other 3 patients, polymerase chain reaction was used, followed by sequencing.
We identified 11 different mutations in the ATM gene. Two patients had mutations as compound heterozygous, while 9 other patients were homozygous for the mutations. Among these, 2 likely pathogenic mutations (ie, c.2639-1G>A and c.7940_7970delTTCCAGCAGACCAGCCAATTACTAAACTTAA) have not been reported.
Our study highlights the significance of next-generation sequencing techniques in identifying novel ATM mutations in A-T patients. Although all reported A-T mutations reside in 1 gene, the absence of a mutation hotspot for this gene necessitates the use of next-generation sequencing techniques. Specifically, we identified 2 mutations that have not been reported previously, emphasizing the importance of continued research in this area. This study provides new insights into the genetic underpinnings of A-T and underscores the potential clinical implications of identifying novel mutations.
Diabetic nephropathy is a microvascular complication that leads to renal injury. Oxymatrine (OMT) is a matrine alkaloid and has been shown to ameliorate diabetic nephropathy. However, it is still unknown whether its mechanism involves podocytes, which play a critical role in diabetic nephropathy.
High glucose-induced podocytes (MPC5) were treated with OMT, the NOD-like receptor protein 3 (NLRP3) inhibitor MCC950, and the sirtuin 1 (SIRT1) inhibitor EX527. The effects on podocyte proliferation and apoptosis were assessed using cell counting kit-8 and flow cytometry. Immunofluorescence staining was performed to detect the expression of podocyte-associated proteins, NLRP3 inflammasome, and SIRT1. The levels of interleukin (IL)-1β and IL-18 were measured by enzyme-linked immunosorbent assay. Additionally, Western blot analysis was conducted to evaluate podocyte-related proteins, NLRP3 inflammasome-dependent pyroptosis-related proteins, and SIRT1/nuclear factor kappa B (NF-κB) pathway proteins, aiming to elucidate the mechanisms by which OMT improves podocyte injury.
OMT significantly promoted the proliferation of podocytes exposed to high glucose, inhibited their apoptosis, increased the levels of nephrin, Wilms tumor 1, podocin, and zonula occludens-1, and reduced pyroptosis-related proteins, IL-1β, and IL-18 (p < 0.05). It also increased SIRT1 and decreased the acetylation of NF-κB p65 (p < 0.05). The NLRP3 inhibitor MCC950 reduced podocyte pyroptosis under high glucose conditions, while the SIRT1 inhibitor EX527 reversed the protective effects of OMT on NLRP3 inflammasome-dependent pyroptosis and podocyte injury.
OMT ameliorates high glucose-induced podocyte injury by regulating the SIRT1/NF-κB pathway and inhibiting NLRP3 inflammasome-dependent pyroptosis.
Osteoporosis (OP), a widespread musculoskeletal disorder characterized by fragile bone fractures, has seen increasing attention regarding immune infiltration-related genes. These genes show significant predictive value in solid tumor prognosis and are now being explored for their roles in musculoskeletal diseases. This study identified osteoporosis-associated differentially expressed immune genes (OP-DEGs) by analyzing the overlap between OP-differentially expressed genes and immune genes.
To elucidate the functional implications of these genes, pathway enrichment analysis was conducted using Gene Ontology and KEGG databases. Additionally, Gene Set Enrichment Analysis (GSEA) and Gene Set Variation Analysis (GSVA) were employed to explore underlying mechanisms. A competitive endogenous RNA (ceRNA) network was constructed for critical OP-related immune genes, and immune infiltration analysis investigated micro-environmental characteristics. The diagnostic effectiveness of OP was evaluated using ROC curves. Finally, RT-PCR determined the expression levels of 15 key OP-related immune genes in OP and control groups.
The study identified 29 OP-DEGs. Extensive bioinformatics analysis pinpointed 15 key genes that could serve as potential biomarkers for OP diagnosis. RT-PCR results revealed significantly increased expression of VEGFA, HMOX1, RARA, CXCL10, hsa-miR-129-2-3p, OIP5-AS1, and HCG18 in the OP group compared to controls.
Our findings suggest that these immune-related genes may predict OP prognosis and offer new perspectives for early prevention and intervention strategies. The identification of specific immune genes involved in OP development highlights their potential as therapeutic targets for further investigation.
Regulatory T cells (Tregs) are central to establishing an immunosuppressive tumor microenvironment (TME), which promotes cancer progression and influences therapeutic outcomes. However, the prognostic significance of Treg-related genes (TRGs) in predicting immunotherapy response in melanoma remains insufficiently characterized. This study seeks to elucidate the role of TRGs in the antitumor immune response of melanoma.
The ordinary transcriptome and single-cell RNA sequencing (scRNA-seq) data were obtained from the gene expression omnibus and the cancer genome atlas databases. A multi-tiered quality control process was applied to scRNA-seq data, followed by cell annotation, cell-cell communication, and enrichment analysis to investigate Treg function in the melanoma microenvironment. Weighted gene coexpression network analysis (WGCNA) was employed to identify modules associated with Treg infiltration.
Key prognostic genes were identified using univariate Cox regression analysis and integrated into a prognostic model through least absolute shrinkage and selection operator and stepwise regression methods. The analysis revealed a Treg-related gene signature (TRGS) comprising CHD3, FOSB, SEMA4D, PSME1, FYN, PRKACB, and ARID5A. Higher TRGS-based risk scores were significantly associated with worse prognoses, immune cell infiltration, and stromal scores.
TRGS was identified as an independent prognostic indicator for melanoma, offering novel insights into the role of Tregs in modulating the TME. This study highlights the potential clinical utility of TRGs in melanoma diagnostics and personalized immunotherapy, providing a robust foundation for future therapeutic strategies.
The severity of coronavirus disease 2019 (COVID-19) varies significantly among individuals, which indicates the impact of individual differences on disease. Emerging evidence suggests that genetic factors play a crucial role in determining the severity of the disease. For instance, variants in the interferon-gamma (IFN-γ) gene, such as the +874 T/A single nucleotide polymorphism (SNP), have been linked to altered immune responses and may influence the severity of COVID-19. We aim to determine the influence of the IFN‐γ +874T/A SNP on the clinical outcomes of COVID-19 patients.
We investigated the SNP at position +874 in the promoter region of the IFN-γ gene in 416 individuals (206 critically ill COVID-19 patients and 210 healthy controls) in northwestern of Iran. Genomic DNA was extracted from the blood leukocytes of the patients, and the SNP was analyzed using the amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) method.
The AA genotype was significantly more frequent in critically ill COVID-19 patients than in healthy controls. Conversely, the AT and TT genotypes were more common in healthy controls. Furthermore, the A allele was more frequent in critically ill patients than in healthy controls, while the T allele was more frequent in healthy controls compared to critically ill patients.
Our study identified the IFN-γ +874T/A SNP as a significant genetic factor influencing COVID-19 severity. This finding underscores the critical role of genetic factors in disease severity and highlights the importance of personalized medicine in managing COVID-19.

This journal is a member of, and subscribes to the principles of, the Committee on Publication Ethics (COPE).
![]() |
All the work in this journal are licensed under a Creative Commons Attribution-NonCommercial 4.0 International License. |