Clinical Characterization and Mutation Analysis of 13 Iranian Ataxia Telangiectasia Patients: Introducing Two Novel Mutations

Ataxia Telangiectasia (A-T) is a rare autosomal recessive neurodegenerative disease caused by mutations in the ataxia telengiectasia mutated (ATM) gene. The gene is on chromosome 11q22-23 and codes for the protein kinase ATM, which plays an essential role in DNA damage repair. In this study, we review the clinical characteristics of 13 A-T patients, 2 of whom displayed novel mutations.
Thirteen patients with ataxia-telangiectasia from 10 unrelated families were referred to Immunology, Asthma and Allergy Research Institute, Tehran, Iran. After clinical confirmation, blood samples were collected from the patients and their parents. Genetic analysis for 8 patients was conducted using whole-exome sequencing; in the other 3 patients, polymerase chain reaction was used, followed by sequencing.
We identified 11 different mutations in the ATM gene. Two patients had mutations as compound heterozygous, while 9 other patients were homozygous for the mutations. Among these, 2 likely pathogenic mutations (ie, c.2639-1G>A and c.7940_7970delTTCCAGCAGACCAGCCAATTACTAAACTTAA) have not been reported.
Our study highlights the significance of next-generation sequencing techniques in identifying novel ATM mutations in A-T patients. Although all reported A-T mutations reside in 1 gene, the absence of a mutation hotspot for this gene necessitates the use of next-generation sequencing techniques. Specifically, we identified 2 mutations that have not been reported previously, emphasizing the importance of continued research in this area. This study provides new insights into the genetic underpinnings of A-T and underscores the potential clinical implications of identifying novel mutations.

1. Rothblum Oviatt C, Wright J, Lefton Greif MA, McGrath Morrow SA, Crawford TO, Lederman HM. Ataxia telangiectasia a review. Orphanet J Rare Dis. 2016;11(1):159. doi:10.1186/s13023 016 0543 7.
2. UniProt Consortium. UniProt the universal protein knowledgebase in 2021. Nucleic Acids Res. 2021;49(D1):D480 d9.
3. Shiloh Y, Ziv Y. The ATM protein kinase regulating the cellular response to genotoxic stress and more. Nat Rev Mol Cell Biol. 2013;14(4):197 210.
4. Stenson PD, Ball EV, Mort M, Phillips AD, Shiel JA, Thomas NS, et al. Human Gene Mutation Database HGMD 2003 update. Human Mut. 2003;21(6):577 81.
5. Seidel MG, Kindle G, Gathmann B, Quinti I, Buckland M, van Montfrans J, et al. The European Society for Immunodeficiencies ESID Registry Working Definitions for the Clinical Diagnosis of Inborn Errors of Immunity. J Allergy Clin Immunol Pract. 2019;7(6):1763 70.
6. Sandoval N, Platzer M, Rosenthal A, Dork T, Bendix R, Skawran B, et al. Characterization of ATM gene mutations in 66 ataxia telangiectasia families. Hum Mol Genet. 1999;8(1):69 79.
7. Amirifar P, Ranjouri MR, Yazdani R, Abolhassani H, Aghamohammadi A. Ataxia telangiectasia A review of clinical features and molecular pathology. Ped Allergy Immunol. 2019;30(3):277 88. doi:10.1111/pai.13020.
8. Bazregari S, Azizi G, Tavakol M, Asgardoon MH, Kiaee F, Tavakolinia N, et al. Evaluation of infectious and non infectious complications in patients with primary immunodeficiency. Central Europ J Immunol. 2017;42(4):336 41.
9. Moin M, Aghamohammadi A, Kouhi A, Tavassoli S, Rezaei N, Ghaffari SR, et al. Ataxia telangiectasia in Iran clinical and laboratory features of 104 patients. Ped Neurol. 2007;37(1):21 8. doi:10.1016/j.pediatrneurol.2007.03.002.
10. Rawat A, Imai K, Suri D, Gupta A, Bhisikar S, Saikia B, et al. Ataxia Telangiectasia Masquerading as Hyper IgM Syndrome. Indian J Pediatr. 2016;83(3):270 1.
11. Szczawinska Poplonyk A, Ossowska L, Jonczyk Potoczna K. Granulomatous Liver Disease in Ataxia Telangiectasia With the Hyper IgM Phenotype A Case Report. Front Pediatr. 2020;8:570330.
12. Noordzij JG, Wulffraat NM, Haraldsson A, Meyts I, van t Veer LJ, Hogervorst FB, et al. Ataxia telangiectasia patients presenting with hyper IgM syndrome. Arch Dis Childhood. 2009;94(6):448 9.
13. Shiloh Y, Lederman HM. Ataxia telangiectasia A T An emerging dimension of premature ageing. Ageing Res Rev. 2017;33:76 88.
14. Tabatabaiefar MA, Alipour P, Pourahmadiyan A, Fattahi N, Shariati L, Golchin N, et al. A novel pathogenic variant in an Iranian Ataxia telangiectasia family revealed by next generation sequencing followed by in silico analysis. J Neurol Sci. 2017;379:212 6. doi:10.1016/j.jns.2017.06.012.
15. Sarmiento E, Mora R, Rodríguez Mahou M, Rodríguez Molina J, Fernández Cruz E, Carbone J. Autoimmune disease in primary antibody deficiencies. Allergologia et immunopathologia. 2005;33(2):69 73.
16. Sanati MH, Bayat B, Aleyasin A, Atashi Shirazi H, Isaian A, Farhoudi A, et al. ATM Gene Mutations Detection in Iranian Ataxia Telangiectasia Patients. Iran J Allergy Asthma Immunol. 2004;3(2):59 63.
17. Keshel SH, Rahimi A, Hancox Z, Ebrahimi M, Khojasteh A, Sefat F. The promise of regenerative medicine in the treatment of urogenital disorders. J Biomed Mater Res A. 2020;108(8):1747 59.
18. Engelhardt EM, Micol LA, Houis S, Wurm FM, Hilborn J, Hubbell JA, et al. A collagen poly lactic acid co e caprolactone hybrid scaffold for bladder tissue regeneration. Biomaterials. 2011;32(16):3969 76.
19. Liu XL, Wang T, Huang XJ, Zhou HY, Luan XH, Shen JY, et al. Novel ATM mutations with ataxia telangiectasia. Neurosci Lett. 2016;611:112 5.
20. Mitui M, Nahas SA, Du LT, Yang Z, Lai CH, Nakamura K, et al. Functional and computational assessment of missense variants in the ataxia telangiectasia mutated ATM gene mutations with increased cancer risk. Human Mut. 2009;30(1):12

Files	XML PDF (639KB)
Issue	Articles in Press
Section	Original Article(s)
Keywords
Ataxia-telangiectasia Ataxia telangiectasia mutated proteins Cerebellar ataxia Iran Mutation Primary immunodeficiency diseases Whole exome sequencing

Rights and permissions
	This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.

How to Cite

Badalzadeh M, Soleimani Bavani M, Alizadeh Z, Mirmoghtadaei M, Shakerian L, Bahram S, Molitor A, Carapito R, Moradi L, Razaghian A, Assari R, Movahedi M, Shariat M, Houshmand M, Habibi L, Hamidieh AA, Ashrafi MR, Fazlollahi MR, Pourpak Z. Clinical Characterization and Mutation Analysis of 13 Iranian Ataxia Telangiectasia Patients: Introducing Two Novel Mutations. Iran J Allergy Asthma Immunol. 2025;:1-11.

Vancouver

Download Citation